ID: 983052346_983052349

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 983052346 983052349
Species Human (GRCh38) Human (GRCh38)
Location 4:163063062-163063084 4:163063076-163063098
Sequence CCTACAAATGTGGTACAGTCCAG ACAGTCCAGGACCCCTGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!