ID: 983058605_983058618

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 983058605 983058618
Species Human (GRCh38) Human (GRCh38)
Location 4:163129033-163129055 4:163129056-163129078
Sequence CCCATGTTTACAGGTGGGGGTGG TGGTGGGGGTGGAGGGCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 276} {0: 1, 1: 1, 2: 20, 3: 426, 4: 10080}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!