ID: 983084652_983084654

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 983084652 983084654
Species Human (GRCh38) Human (GRCh38)
Location 4:163428038-163428060 4:163428072-163428094
Sequence CCTATCCAGCAGGAAGTAGCTAG CTCAATTCGCAACTGCAGTTAGG
Strand - +
Off-target summary {0: 131, 1: 96, 2: 63, 3: 198, 4: 326} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!