ID: 983096738_983096739

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 983096738 983096739
Species Human (GRCh38) Human (GRCh38)
Location 4:163571309-163571331 4:163571322-163571344
Sequence CCAGAATGTAAATTCTCTGAGGT TCTCTGAGGTCAGAAGATTCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 35, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!