|
Left Crispr |
Right Crispr |
| Crispr ID |
983138790 |
983138793 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:164122309-164122331
|
4:164122350-164122372
|
| Sequence |
CCAACTTATTTTCCTTTCTAACT |
CAAGCTGCAGACATAGATATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 30, 3: 98, 4: 817} |
{0: 1, 1: 1, 2: 13, 3: 65, 4: 203} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|