|
Left Crispr |
Right Crispr |
| Crispr ID |
983141513 |
983141521 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:164155148-164155170
|
4:164155201-164155223
|
| Sequence |
CCAAAAGGCAACTTTTTGGCTGC |
CTGTGGGTATCCAGGCTTAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 17, 2: 42, 3: 74, 4: 215} |
{0: 1, 1: 2, 2: 28, 3: 77, 4: 205} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|