ID: 983212120_983212123

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 983212120 983212123
Species Human (GRCh38) Human (GRCh38)
Location 4:164969610-164969632 4:164969648-164969670
Sequence CCAAACACAGTGATGCTGGTGAT ACCTTGGACATAAAAGCTCTAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 10, 4: 195} {0: 3, 1: 0, 2: 1, 3: 24, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!