ID: 983217647_983217652

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 983217647 983217652
Species Human (GRCh38) Human (GRCh38)
Location 4:165017021-165017043 4:165017043-165017065
Sequence CCCTGTCCCATCTGTCCTCACTA ACTTCCCTGACCAGAACCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 354} {0: 1, 1: 0, 2: 1, 3: 20, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!