ID: 983237275_983237278

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 983237275 983237278
Species Human (GRCh38) Human (GRCh38)
Location 4:165193688-165193710 4:165193737-165193759
Sequence CCTCTGCATATGATTACAGTTTT CTCCTATGTGTCCCTCAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 208} {0: 1, 1: 0, 2: 2, 3: 11, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!