ID: 983243786_983243791

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 983243786 983243791
Species Human (GRCh38) Human (GRCh38)
Location 4:165264016-165264038 4:165264046-165264068
Sequence CCTTGCTTTAGCTGCTCTTCAGG GACCCCTCATCTCTGCAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 16, 4: 186} {0: 1, 1: 1, 2: 0, 3: 12, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!