ID: 983279663_983279667

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 983279663 983279667
Species Human (GRCh38) Human (GRCh38)
Location 4:165664777-165664799 4:165664810-165664832
Sequence CCCTGGAGACAGGAGAAGGAAGA CTGAATAGACTGAGGGACCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 65, 4: 649} {0: 1, 1: 0, 2: 1, 3: 23, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!