ID: 983287521_983287526

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 983287521 983287526
Species Human (GRCh38) Human (GRCh38)
Location 4:165758754-165758776 4:165758798-165758820
Sequence CCCAGGGTAGTTTTCAGAGCTCC CTGTTAGGATGCAGAAGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!