ID: 983298974_983298977 |
View in Genome Browser |
Spacer: -7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 983298974 | 983298977 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:165901751-165901773 | 4:165901767-165901789 |
| Sequence | CCTTAGCAGAGCTGGAGTGCTGT | GTGCTGTTCTGGGAGATCCATGG |
| Strand | - | + |
| Off-target summary | {0: 6, 1: 142, 2: 347, 3: 592, 4: 728} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||