ID: 983303115_983303119

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 983303115 983303119
Species Human (GRCh38) Human (GRCh38)
Location 4:165952864-165952886 4:165952890-165952912
Sequence CCCCACTAAAGAGCAAGAATGGG TAAAAGAAACAGAAAACTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 116} {0: 1, 1: 0, 2: 14, 3: 149, 4: 1478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!