ID: 983317461_983317465

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 983317461 983317465
Species Human (GRCh38) Human (GRCh38)
Location 4:166149963-166149985 4:166150005-166150027
Sequence CCCAGTCTCGGGCAGCCTTTTAT AATATATTGGTACATTCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 275, 4: 1692} {0: 1, 1: 0, 2: 3, 3: 40, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!