ID: 983317463_983317465

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 983317463 983317465
Species Human (GRCh38) Human (GRCh38)
Location 4:166149978-166150000 4:166150005-166150027
Sequence CCTTTTATAGCAGCATGAGAATG AATATATTGGTACATTCTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 40, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!