ID: 983377560_983377569

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 983377560 983377569
Species Human (GRCh38) Human (GRCh38)
Location 4:166949567-166949589 4:166949616-166949638
Sequence CCTTAGCTGCACGTCTGTTGGAG GTTTGCCTGGGTATCCACAGCGG
Strand - +
Off-target summary No data {0: 8, 1: 42, 2: 2217, 3: 1674, 4: 864}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!