|
Left Crispr |
Right Crispr |
| Crispr ID |
983379029 |
983379032 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:166967865-166967887
|
4:166967892-166967914
|
| Sequence |
CCTAGAGACTTACTGAATGGTTA |
CAAAATGCTGATAGTGATGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 82, 3: 697, 4: 2509} |
{0: 3, 1: 43, 2: 79, 3: 85, 4: 309} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|