ID: 983380071_983380075 |
View in Genome Browser |
Spacer: 18 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 983380071 | 983380075 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 4:166981101-166981123 | 4:166981142-166981164 |
Sequence | CCTTTCTGCAGGCAGGTCGTTCC | AGCCCAGAGGAGACCCATAGTGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 10, 2: 73, 3: 269, 4: 553} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |