ID: 983380071_983380075

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 983380071 983380075
Species Human (GRCh38) Human (GRCh38)
Location 4:166981101-166981123 4:166981142-166981164
Sequence CCTTTCTGCAGGCAGGTCGTTCC AGCCCAGAGGAGACCCATAGTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 73, 3: 269, 4: 553} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!