ID: 983380072_983380082

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 983380072 983380082
Species Human (GRCh38) Human (GRCh38)
Location 4:166981122-166981144 4:166981164-166981186
Sequence CCAACAAGTGTCCAGCTTTCAGC GGTAGCTCCTTTCCACAGGAAGG
Strand - +
Off-target summary No data {0: 3, 1: 57, 2: 169, 3: 345, 4: 605}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!