ID: 983388840_983388845

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 983388840 983388845
Species Human (GRCh38) Human (GRCh38)
Location 4:167102799-167102821 4:167102824-167102846
Sequence CCATAAGGACTGTAATTGCTAGG AGTCCTAGGCTCAGAGACAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 99, 4: 448} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!