ID: 983447848_983447853

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 983447848 983447853
Species Human (GRCh38) Human (GRCh38)
Location 4:167877206-167877228 4:167877227-167877249
Sequence CCTTCTCCTTCACCCTTAGTGGC GCAAGTCCCGCTTTTCTTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 50, 2: 182, 3: 156, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!