ID: 983469744_983469753

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 983469744 983469753
Species Human (GRCh38) Human (GRCh38)
Location 4:168141887-168141909 4:168141920-168141942
Sequence CCAGGTTTGTGGGGCCCTCCCTT AGTGCGCATGCGTGGGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 13, 3: 27, 4: 179} {0: 1, 1: 0, 2: 2, 3: 7, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!