ID: 983494494_983494505

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 983494494 983494505
Species Human (GRCh38) Human (GRCh38)
Location 4:168427960-168427982 4:168427997-168428019
Sequence CCCATCAGTTCCTGGCCCTGCAA GGAGCAGAGGTGCACAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162} {0: 1, 1: 0, 2: 4, 3: 46, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!