ID: 983502316_983502321

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 983502316 983502321
Species Human (GRCh38) Human (GRCh38)
Location 4:168513194-168513216 4:168513247-168513269
Sequence CCTTCAATGTGATGCAAAGAAGG AATCAAGTCAGGAGCTCCGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!