ID: 983534868_983534872

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 983534868 983534872
Species Human (GRCh38) Human (GRCh38)
Location 4:168846701-168846723 4:168846732-168846754
Sequence CCTCTAACTGCAGGCTTCTTCCG AAGGGCTTTCTGAAAAGCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!