ID: 983547688_983547704 |
View in Genome Browser |
Spacer: 30 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 983547688 | 983547704 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 4:168979973-168979995 | 4:168980026-168980048 |
Sequence | CCCTGCTCTTCACCAGGCAGGGC | ATGATTATTCTGATGGACAATGG |
Strand | - | + |
Off-target summary | {0: 4, 1: 25, 2: 54, 3: 93, 4: 374} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |