ID: 983547693_983547704

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 983547693 983547704
Species Human (GRCh38) Human (GRCh38)
Location 4:168979995-168980017 4:168980026-168980048
Sequence CCCCCCCAGCTTGGGCCCACAAC ATGATTATTCTGATGGACAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 17, 4: 240} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!