ID: 983547695_983547704 |
View in Genome Browser |
Spacer: 6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 983547695 | 983547704 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:168979997-168980019 | 4:168980026-168980048 |
| Sequence | CCCCCAGCTTGGGCCCACAACAC | ATGATTATTCTGATGGACAATGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 7, 2: 32, 3: 84, 4: 429} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||