ID: 983561774_983561782

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 983561774 983561782
Species Human (GRCh38) Human (GRCh38)
Location 4:169108826-169108848 4:169108878-169108900
Sequence CCTAGTGCAGGGCCCTACACCTA AAGAGGATGAAACCAGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 361} {0: 1, 1: 0, 2: 0, 3: 32, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!