ID: 983562825_983562832

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 983562825 983562832
Species Human (GRCh38) Human (GRCh38)
Location 4:169118065-169118087 4:169118096-169118118
Sequence CCACTGACTTTCAAGGCCCTGGA CTTCATCTACAGAACAAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 202} {0: 1, 1: 0, 2: 3, 3: 30, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!