ID: 983564418_983564422

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 983564418 983564422
Species Human (GRCh38) Human (GRCh38)
Location 4:169134134-169134156 4:169134148-169134170
Sequence CCTCCCAGCCTCTTCTAGAAATA CTAGAAATAACTTCTCCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 358} {0: 1, 1: 0, 2: 2, 3: 22, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!