ID: 983622399_983622411

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 983622399 983622411
Species Human (GRCh38) Human (GRCh38)
Location 4:169774804-169774826 4:169774831-169774853
Sequence CCCTTGGGGAGCCCCCATCCTAT CTGTGGACCGGGGCGTCTCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 15, 4: 127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!