ID: 983633696_983633704

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 983633696 983633704
Species Human (GRCh38) Human (GRCh38)
Location 4:169876495-169876517 4:169876541-169876563
Sequence CCGCACCCGGCCCCATTCTGCTT GAGGCCCACCAAAATTATCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 35, 3: 216, 4: 1435} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!