ID: 983654549_983654553

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 983654549 983654553
Species Human (GRCh38) Human (GRCh38)
Location 4:170069522-170069544 4:170069539-170069561
Sequence CCAGAGGTTGAAATCCAGGATTA GGATTAACAGACTTACAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!