|
Left Crispr |
Right Crispr |
| Crispr ID |
983810059 |
983810063 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:172050581-172050603
|
4:172050602-172050624
|
| Sequence |
CCCTTTATCTGAGGTCTATGTGC |
GCCAGTGGACCCATTTGGTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 20, 2: 42, 3: 82, 4: 294} |
{0: 2, 1: 4, 2: 27, 3: 51, 4: 136} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|