ID: 983843139_983843148

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 983843139 983843148
Species Human (GRCh38) Human (GRCh38)
Location 4:172481944-172481966 4:172481974-172481996
Sequence CCGTCGGGGAGGCTCGGGCTGCC CACCGCAGGGGGCTCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 12, 3: 49, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!