ID: 983877529_983877536

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 983877529 983877536
Species Human (GRCh38) Human (GRCh38)
Location 4:172893940-172893962 4:172893953-172893975
Sequence CCCCTTCCTTAGGACCTAGTCAG ACCTAGTCAGGTTTGGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 126} {0: 1, 1: 0, 2: 0, 3: 14, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!