ID: 983886125_983886130

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 983886125 983886130
Species Human (GRCh38) Human (GRCh38)
Location 4:172982494-172982516 4:172982546-172982568
Sequence CCAGTCTATACATAAGACAATGG TGAAGTCTACAATTAGTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 160} {0: 1, 1: 0, 2: 1, 3: 13, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!