ID: 983904451_983904455

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 983904451 983904455
Species Human (GRCh38) Human (GRCh38)
Location 4:173169253-173169275 4:173169269-173169291
Sequence CCGGGACTGCGGGCGGAGCGGGC AGCGGGCGGAGAGCCGGGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 263} {0: 1, 1: 1, 2: 1, 3: 17, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!