ID: 983904451_983904456

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 983904451 983904456
Species Human (GRCh38) Human (GRCh38)
Location 4:173169253-173169275 4:173169270-173169292
Sequence CCGGGACTGCGGGCGGAGCGGGC GCGGGCGGAGAGCCGGGTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 263} {0: 1, 1: 1, 2: 1, 3: 33, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!