ID: 983904451_983904462

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 983904451 983904462
Species Human (GRCh38) Human (GRCh38)
Location 4:173169253-173169275 4:173169287-173169309
Sequence CCGGGACTGCGGGCGGAGCGGGC TCCGGGGGGCTGCGGCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 263} {0: 1, 1: 0, 2: 2, 3: 26, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!