|
Left Crispr |
Right Crispr |
| Crispr ID |
983923943 |
983923951 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:173376018-173376040
|
4:173376059-173376081
|
| Sequence |
CCACCCTCAATCTGTGCAAAAAT |
TCTCTGGTGCCAAAAAGGTTGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 78, 1: 1103, 2: 1667, 3: 1354, 4: 955} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|