ID: 983946795_983946798

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 983946795 983946798
Species Human (GRCh38) Human (GRCh38)
Location 4:173595126-173595148 4:173595169-173595191
Sequence CCCGGCCAAAAATATATATTTAA CTATGTCACAATGAGAAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 68, 3: 446, 4: 2531} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!