ID: 983973464_983973470

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 983973464 983973470
Species Human (GRCh38) Human (GRCh38)
Location 4:173902482-173902504 4:173902535-173902557
Sequence CCTGAGACCTACTGAGTAAAAGT GTTTCGTTTTGTTTAGTGACCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 41, 3: 500, 4: 1242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!