ID: 984005387_984005391

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 984005387 984005391
Species Human (GRCh38) Human (GRCh38)
Location 4:174299879-174299901 4:174299919-174299941
Sequence CCTTCATAATTCTGTTTCTTCAT TTTTATCATTGATTAATTGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 75, 4: 631} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!