|
Left Crispr |
Right Crispr |
Crispr ID |
984041185 |
984041192 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:174735769-174735791
|
4:174735810-174735832
|
Sequence |
CCAGGCTGGTCTGGAACTCCTGA |
CGTCAGCCTCCCAAAGTGTTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 3961, 1: 108540, 2: 173561, 3: 217028, 4: 147244} |
{0: 40, 1: 8391, 2: 114523, 3: 233321, 4: 244023} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|