ID: 984041775_984041782

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 984041775 984041782
Species Human (GRCh38) Human (GRCh38)
Location 4:174744105-174744127 4:174744155-174744177
Sequence CCATCAAAAGTAGTTAGGCCTGA CAACCCAGCATTGCAGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 91} {0: 1, 1: 0, 2: 3, 3: 19, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!