ID: 984045572_984045578

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 984045572 984045578
Species Human (GRCh38) Human (GRCh38)
Location 4:174793527-174793549 4:174793562-174793584
Sequence CCCGCAACGTTGAACTTCTGGGC CCTGTGTCAGCCGCCTAATGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 140, 4: 479} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!