ID: 984054513_984054517

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 984054513 984054517
Species Human (GRCh38) Human (GRCh38)
Location 4:174910333-174910355 4:174910378-174910400
Sequence CCACACCAGGTACTCACAGGGAA GCCTCCCTCATGGTGCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 52, 4: 225} {0: 1, 1: 0, 2: 4, 3: 33, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!